Cycle Sequencing Kits

When the next time around is always better. Date: July 21, 1997 Comparison Chart DNA sequencing methods have come a long way in 20 years. From the chemical method of Maxam and Gilbert and the dideoxy method of Sanger, DNA sequencing techniques evolved into the "labeling/termination" method that used a modified T7 DNA polymerase such as Sequenase. Propelled by the power and potential of DNA amplification using thermal cycling strategies, earlier DNA sequencing methodologies have increasingly been supplanted by cycle sequencing methods. At the heart of the thermal cycle sequencing reaction beats the eloquence of Sanger's dideoxy DNA sequencing technique. Here, a DNA polymerase synthesizes a complementary copy of a single-stranded DNA template, beginning from the 3' end of a DNA primer that has been annealed to the template strand. The Sanger dideoxy chain termination method takes advantage of the polymerase's ability to use 2',3'-dideoxynucleoside triphosphates (ddNTPs) as substrates in addition to the normal deoxynucleotide triphosphate (dNTP) bases. When the polymerase incorporates a ddNTP into the growing primer chain, elongation stops, and the newly synthesized complementary chain is terminated at positions representing either A, C, G, or T base, depending on which ddNTP-base analog was incorporated. Elongation terminates because of the absence of the 3'-hydroxyl group on the ddNTP, normally present on the dNTP and required for chain elongation. The usual game plan when sequencing a DNA fragment calls for the preparation of four sequencing reactions, one reaction per ddNTP analog. By adjusting the ratio of dNTPs to ddNTPs, the elongating primer chains ideally terminate wherever that specific base occurs along the length of the template fragment. The resulting sequencing reaction forms a nested population ladder of extended primer sequences, each ending with the specific dideoxynucleotide analog used in that reaction. Radioactive, chemiluminescent, or fluorescent labels incorporated into the nucleotides or primers enable the visualization of the four sequencing reaction products when run side by side on an acrylamide gel. The data obtained from the gel reveals the sequence of the DNA template. The adaptation of the Sanger dideoxy sequencing method for use in thermal cyclers, referred to as dideoxy-terminator cycle sequencing, has conveyed advantages and improvements to the Sanger method. In many ways similar to the standard DNA sequencing reaction, cycle sequencing begins with a standard sequencing reaction mixture of buffer, template, primer, dNTPs, and ddNTPs. A thermostable DNA polymerase replaces the standard polymerase, however. This mixture is subjected to the usual rounds of denaturation, annealing, and extension steps one expects to perform in a thermal cycler amplification reaction. Unlike a normal DNA amplification, which uses two primers to exponentially amplify the template, cycle sequencing uses only one primer to linearly amplify the extension products. Because of the repeated cycling of the reaction, far less template is required for cycle sequencing than for the older dideoxy methods. Additionally, by denaturing the double-stranded template before each primer annealing step during the temperature cycling round, the need to prepare single-stranded templates as once was the norm for DNA sequencing is eliminated. As an added bonus, the double-stranded templates have the convenient benefit of permitting sequencing with both forward and reverse primers so that a single template preparation can be used to generate sequence data from both strands of DNA. Not willing to let a good thing go by, manufacturers supplying the biotechnology marketplace have naturally developed several kits to aid researchers with their cycle sequencing needs. A variety of kits are now available and offer researchers several choices. To begin with, three radioactive isotopes, 32P, 33P, and 35S, are available for incorporation into newly synthesized primer chains as labeled dideoxy terminators, labeled dNTPs, or labeled primers. New, thermostable DNA polymerases are offered as alternatives to the ubiquitous Taq polymerase. These enzymes have advantageous modifications and will more uniformly incorporate each of the four ddNTPs, providing higher quality and longer-read sequence data. Many kits also contain the GTP analog 7-deaza-dGTP to help with sequencing compressions. Additionally, some kits vary in their composition, providing gel loading buffers, stop solutions, and other reagents not normally found in other kits. One of the most recent advances in cycle sequencing has been the incorporation of fluorescent labels into the ddNTPs or the sequencing primers. This has led to the "four-dye, one-lane" fluorescent dye sequencing format now popular with most automated DNA sequencing instrumentation. By labeling each ddNTP or primer with one of four separate fluorescent tags, all four reaction products can now be run on a single lane of an acrylamide gel. A laser beam traversing the bottom of the gel excites the fluors and, as each tag fluoresces at a different wavelength, a detector readily determines the four bases. A few companies offer cycle sequencing kits that include fluorescent or infrared dyes, especially (but not limited to) those that manufacture the automated DNA sequencing instruments. To provide you with a look at some of the available options, LabConsumer invited several companies to submit brief descriptions of their cycle sequencing kits. When selecting a cycle sequencing kit, identify the requirements of your particular application, and then compare the products that best suit your needs. For example, how many templates are involved, and how much of each is available? What isotope is preferred? Is chemiluminescence a concern? Is fluorescent or infrared automated sequencing an option? How many bases need to be sequenced? Are labeled primers preferred or are labeled ddNTPs? Is there a preferred DNA polymerase? Are problems with G/C compressions anticipated? Are other reagents, such as gel loading buffers or stop solutions, needed and available, or is it easier to buy them with the kit? The answers to these questions will provide guidance as to which kit to use. We hope you'll find a product that will help increase the efficiency and productivity of your sequencing. AmershamTM Life Science Thermo Sequenase Radiolabeled Terminator Cycle Sequencing System DYEnamic Energy Transfer Primers DYEnamic Direct Dye-Primer Cycle Sequencing Kit Thermo Sequenase Dye-Terminator Cycle Sequencing Kits AmershamTM Life Science provides a range of cycle sequencing kits containing Thermo Sequenase, a heat-stable exonuclease-free DNA polymerase containing premixed inorganic pyrophosphatase. Thermo Sequenase possesses a genetic modification that removes discrimination against ddNTP incorporation, thus producing very even signal intensities in radioactive and fluorescent cycle sequencing applications. For radioactive dideoxy terminator cycle sequencing, Amersham has created the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing System (188403). This kit includes Thermo Sequenase DNA polymerase, reaction buffer, Nucleix PlusTM dGTP and dITP termination master mixes, RedivueTM 33P-labeled ddNTPs, control pUC18 DNA, universal primer, and formamide stop solution. Radiolabeled terminators eliminate enzyme stops and background caused by premature terminations, and dITP eliminates compression artifacts, producing artifact-free sequencing data. For fluorescent dye-primer sequencing, Amersham provides dyenamicTM Energy Transfer (ET) primers. dyenamicTM ET primers have two fluorescent dyes attached to the same primer molecule. The donor dye (FAM) absorbs light at the wavelength of the argon laser and transfers the absorbed energy to the acceptor dye (REG, FAM, TAMRA, or ROX). Amersham reports that signal strengths of ET primers are 6 to 12 times greater than those of primers having signal dyes, thus providing longer read lengths, reduced cycle times, and reduced template usage. Amersham produces a variety of ET primers for use in all dye-primer sequencing applications, including-21 and-40 forward,-28 and-29 reverse, SP6, T7, T3, and poly T (N). Amersham has introduced DYEnamic Direct Dye-Primer Cycle Sequencing Kits, containing either dGTP (US 79520) or 7-deaza-dGTP (US 79525). These kits include premixes for A, C, G, and T reactions (containing Thermo Sequenase, reaction buffer, dNTPs, and ddNTPs), control pUC18 DNA, and a new bright pink formamide loading dye. Amersham also provides DYEnamic Direct kits premixed with either -21 forward or -28 reverse ET primers and containing either dGTP (US 79620/79720) or 7-deaza dGTP (US 79625/79725). These kits, optimized for Thermo Sequenase and ET primers, provide high signal intensities, allowing users in many cases to directly load their sequencing reactions onto a gel without performing ethanol precipitation. Recently, Amersham introduced Thermo Sequenase Dye-Terminator Cycle Sequencing Kits. The reagent in the premix kit (US 79765) contains Thermo Sequenase, reaction buffer, dNTPs, and dye-labeled ddNTPs, while the core kit (US 79565) contains each of these reagents separately. Both kits contain control M13mp18 DNA, universal primer, ammonium acetate, and the new bright pink formamide loading dye, and both reportedly provide high-quality sequence data and ease of use. Amersham, Thermo Sequenase, Nucleix Plus, Redivue, and DYEnamic are trademarks of Amersham International plc. *7-deaza-dGTP is licensed from Boehringer Mannheim GmbH All goods and services are sold subject to the terms and conditions of sale of the company within the Amersham Group that supplies them. A copy of these terms and conditions is available upon request. Boehringer Mannheim DIG Taq DNA Sequencing Kit DNA Sequencing Kit, Taq IR Taq DNA Sequencing Kit Long Range Termination Set for Taq Sequencing Luminescent Detection Set for DIG Sequencing Fluorescent Labeled Primer Cycle Sequencing Kit Boehringer Mannheim's DIG Taq DNA Sequencing Kit provides the materials for sequencing PCR-amplified DNA templates or DNA templates from plasmids, cosmids and phages. Sequencing GC-rich or palindromic-rich templates can be performed with this kit as well. The DNA Sequencing Kit, Taq, is for standard sequencing of single-and double-stranded DNA templates, cycle sequencing of DNA templates, and direct sequencing of PCR products. GC-rich or palindromic-rich templates can be handled by this kit also. Boehringer Mannheim's IR Taq DNA Sequencing Kit has been designed for standard and cycle sequencing of single-and double-stranded DNA templates (e.g., PCR products, l DNA, cosmid DNA) with infrared-labeled primers in the automated DNA sequencers LI-COR 4000 S or 4000 L. The Long Range Termination Set for Taq Sequencing generates extended sequence ladders using Taq DNA polymerase in standard and cycle sequencing of single-and double-stranded DNA. For faster chemiluminescent detection of digoxigenin-labeled sequencing products on nylon membranes, Boehringer Mannheim offers the Luminescent Detection Set for DIG Sequencing. The Fluorescent Labeled Primer Cycle Sequencing Kit has been formulated for fluorescent sequencing using either 4 dye primer or single primer protocols. This kit is optimized to give long read length, generating labeled fragments suitable for detection on fluorescent sequencing instruments. The "load-and-go" premixed components are stable at 4°C. The kit is available with dGTP or 7-deaza-dGTP to overcome compressions. CHIMERx CYCLE-SEQUAL DNA Sequencing System CHIMERx (Madison, WI) offers a wide range of kits for biological research. The CYCLE-SEQUALTM DNA Sequencing System is a versatile tool for acquiring sequence information from a variety of templates utilizing either radiolabeled or fluorescent primers. This system contains all of the components required for thermal cycle sequencing using an end-labeled primer. The high reaction temperature of the CYCLE-SEQUAL DNA Sequencing System (65°C) permits polymerization through secondary structures and increases the stringency of primer hybridization. CYCLE-SEQUAL DNA Polymerase yields consistent uniform band intensities and minimal sequencing artifacts using double-stranded templates such as plasmids, cosmids, and bacteriophage lambda, as well as single-stranded vectors. The CYCLE-SEQUAL system utilizes a g-32P end-labeled primer for sequencing. Alternatively, a fluorescent, biotin, or other non-isotopically labeled primer may be utilized with this system and yield equivalent results. The end-labeled primer protocol yields high quality data for demanding applications, such as PCR-and GC-rich templates. This method of labeling is designed to be simple, rapid, tolerant of dirty templates and requires a minimum of pipetting steps. Each kit contains sufficient reagents for 100 sets of sequencing reactions. The kit includes CYCLE-SEQUAL DNA Polymerase and buffer, T4 Polynucleotide Kinase and buffer, each of the four d/ddNTP mixes, stop solution, M13/pUC Forward Sequencing Primer (-47), 24 mer 5'd(CGCCAGGGTTTTCCCAGTCACGAC)3', M13MP18 ssDNA control, and complete protocols and documentation. Display Systems Biotech cycleSEQ Automated Ready-To-Run Cycle Sequencing Kit cycleSEQ Manual Ready-To-Run Cycle Sequencing Kit cycleSEQTM Cycle Sequencing Kits provide researchers with a simple, rapid, and reliable method for obtaining high-quality sequence data from a wide variety of templates including PCR products, plasmids, and large DNAs such as lambda phage or cosmids. For automated sequencing using laser fluorescent detection systems, Display Systems Biotech provides the cycleSEQTM Automated Ready-To-Run Sequencing Kit. The key player in this kit is the new cycle sequencing enzyme cycleSEQTM, a thermostable DNA polymerase specifically engineered for DNA cycle sequencing of a wide variety of DNA templates using either fluorescent-labeled primers or radioactive-labeled primers. Display Systems Biotech reports that the increased thermostability of this enzyme allows effective sequencing through problematic regions containing inverted or direct repeats, hairpin loops, interstrand reannealing, or template with high GC content. The cycleSEQTM Manual Ready-To-Run Cycle Sequencing Kit is manufactured for radioactive sequencing of PCR products and plasmid DNA. Like its partner, the Automated Cycle Sequencing Kit, the Manual Cycle Sequencing Kit utilizes cycleSEQTM, which was engineered with the premise that radiolabeled primer cycle sequencing is the easiest, most reliable, and least expensive method for sequencing PCR products and plasmid DNA. Unlike 3-dNTP internal cycle sequencing, the radiolabeled primer protocol requires no knowledge of the downstream sequence for primer design. Also, following Display Systems Biotech's protocol for manual sequencing allows for the use of pre-constructed primers. A cycleSEQTM Ready-To-Run Cycle Sequencing Kit contains all of the necessary reagents for sequencing except radioactivity and fluorescent-labeled primers. Epicentre SequiTherm EXCEL DNA Sequencing Kit SequiTherm EXCEL Long-ReadTM DNA Sequencing Kit-LC Incorporating several DNA sequencing innovations (U.S. and international patents pending), the SequiTherm EXCELTM Kits from Epicentre Technologies (Madison, WI) allow researchers to sequence a broad range of templates. These include very difficult templates with regions of high GC content, inverted or direct repeats, dinucleotide repeats, homopolymeric stretches, hairpin loops, and localized areas of interstrand reannealing. In addition, SequiTherm EXCEL Kits are designed to reduce nonspecific background signal, resulting in clearer, less ambiguous data for all types of DNA templates. SequiTherm EXCEL Kits contain Sequitherm EXCEL II DNA Polymerase, which is designed to improve signal intensities. Cycle sequencing with the SequiTherm EXCEL Kit can be performed using internal-or end-labeled 32P, 33P, or 35S. The Sequitherm EXCEL Long-Read Kit is designed for use with LI-COR, automated DNA sequencers (Models 4000, 4000s, and 4000L) using fluorescent-labeled primers. Both kits contain all necessary buffers, mixes, and control template. Fluorescently labeled M13 forward or reverse primers are available as options with the SequiTherm EXCEL Long-Read Kit. GENOMYX Delta-Genozyme Cycle Sequencing Kit GENOMYX Corporation's new cycle sequencing kit is based on its proprietary Delta-Genozyme thermostable DNA polymerase, which exhibits high thermal stability, aggressive DNA synthesis activity, high processivity, and no detectable exonuclease activity due to modification of the amino terminal region. Sequencing data are touted to be crisp and brilliant with reduced background and artifacts. Genomyx reports that the durability and aggressiveness of Delta-Genozyme allows for long reads of up to 650-700* bases. Dropouts are greatly reduced and secondary structures and GC-rich templates are easily sequenced without the data loss associated with compressions and other artifacts. Each Delta-Genozyme Cycle Sequencing Kit includes proprietary Delta-Genozyme polymerase; G, C, A, and T Reaction Mixes; 5X Reaction Buffer; pTTQ control sequencing template; M13 universal forward sequencing primer; stop mix; and sterile deionized water. *The Delta-Genozyme Cycle Sequencing Kit is LR-Optimized to maximize sequencing data throughput when used in conjunction with the genomyxLR and HR-1000 gel formulations. GENPAK Limited MASH Sequencing Kit FLASH Sequencing Kit LASH Sequencing Kit AASH Sequencing Kit halfTERM Dye Terminator Sequencing Reagent halfTERM XL Dye Terminator Sequencing Reagent Operating from the United Kingdom, GENPAK Limited manufactures several DNA sequencing kits and related products. The MASH kit provides all reagents for manual sequencing using end-labeled primers (not supplied) on single and double-stranded DNA templates. The FLASH, LASH, and AASH kits provide all the reagents necessary for fluorescence based dye primer sequencing reactions using single or double stranded templates for the ABI automated sequencers, the LI-COR automated sequencers, and the ALF EXPRESS automated sequencing system, respectively. These four kits all include enzyme; premixed A, C, G, and T sequencing cocktails containing a stabilizer; and loading buffer. For fluorescent dye terminator sequencing, GENPAK Limited sells a unique, specially formulated sequencing reagent called halfTermTM. The addition of an equal volume of halfTERMTM to sequencing reactions using ABI or Amersham dye terminators results in at least a 40% reduction in dye terminator costs. According to GENPAK, the read length, sequence accuracy, and resolution obtained with halfTERMTM are the same as those obtained from unmodified reactions. Also available from GENPAK is the halfTERMTMXL Dye Terminator Sequencing Reagent, which was formulated to provide robust sequencing of BACs, P1s, and cosmids. Free samples of terminator reagents are available by request at GENPAK Limited's e-mail address. Life Technologies (GIBCO BRL) dsDNA Cycle Sequencing System Life Technologies' dsDNA Cycle Sequencing System teams up dideoxy sequencing with a thermal cycler to produce long, readable DNA sequences. The company reports that the dsDNA Cycle Sequencing System is easy to use and can sequence PCR fragments, plasmids, and cosmids. High temperature cycling makes it especially useful for PCR fragments and eliminates time-consuming alkali denaturing. The linear amplification obtained allows sequencing from very small amounts of DNA - as little as 5 fmol. The dsDNA Cycle Sequencing System generates over 500 bases of sharp readable sequence using 33P or 32P nucleotides. New England BioLabs CircumVent DNA Sequencing Kit New England BioLabs' CircumVentTM DNA Sequencing Kit has been designed around its Vent (exo-) DNA Polymerase. This polymerase was originally obtained from a bacterium found near deep-sea hydrothermal vents and, according to the company, exhibits excellent thermostability and fidelity twice that of Taq DNA polymerase. The use of Vent (exo-) DNA Polymerase with its 6.7-hour half-life at 95°C allows sequencing at high temperatures, crucial for obtaining sequence data from DNA templates that have a high degree of secondary structure and may be recalcitrant to sequencing at lower temperatures. The kit allows direct sequencing from colonies, plaques, cosmids, PCR reactions, or DNA fragments isolated from agarose gels and is compatible with radiolabel or Phototope chemiluminescent detection and automated fluorescent detection using end-labeled primers. Only femtomole amounts of template are required for the CircumVentTM DNA Sequencing Kit. As little as 10 ng of M13 single-stranded DNA, 20 ng of double-stranded DNA, or 300 ng of lgt11 DNA are needed when 32P end-labeled primers are used. New England BioLabs offers 50 and 100 reaction kits, each including Vent (exo-) DNA Polymerase, sequencing buffer, dNTP and ddNTP mixes, Triton-X-100, stop/loading dye, control DNA template and primer, and detailed instructions. PE Applied Biosystems AmpliCycle Sequencing Kit ABI PRISM Cycle Sequencing Kit PE Applied Biosystems (Division of Perkin-Elmer) offers the manual sequencing lab a novel enzyme - AmpliTaq DNA Polymerase CS (Cycle Sequencing). This enzyme is not a deletion mutant; a single point mutation virtually eliminates 5' to 3' exonuclease activity while retaining the processivity, extension rate, and thermal stability of wild-type Taq. The results obtained are high-accuracy sequencing data with even band intensities, fewer false terminations, and none of the background associated with using wild-type Taq for sequencing. With the AmpliCycle Sequencing Kit, sequencing ladders can be generated directly from a variety of double-stranded templates including PCR products, bacterial colonies, or phage plaques. The kit allows flexibility in using 35S, 32P, or 33P radiolabels with either direct incorporation or end-labeled primer strategies. If the template is limited, the protocol requiring only 1 fmol of template can be followed. If the template is abundant, exposure times can be shortened. For the high-throughput sequencing lab, PE Applied Biosystems offers ABI PRISMTM Cycle Sequencing Kits that feature an enhanced version of the AmpliTaq DNA polymerase CS (Cycle Sequencing) mutant. According to PE Applied Biosystems, this new enzyme, AmpliTaq DNA Polymerase, FS (Fluorescent Sequencing) incorporates ddNTPs with higher efficiency, thus generating a more intense fluorescent signal. As a result, the company reports that the amount of template required for dye terminator chemistry can be reduced by at least 50%. In dye primer chemistry, efficient ddNTP incorporation results in more uniform peak heights, increasing the accuracy of automated base calling. Pharmacia Biotech Cycle Sequencing Kit AutoCycle Sequencing Kit Pharmacia Biotech offers its Cycle Sequencing Kit for generating more than 500 bases of readable sequence from as little as 50 fmol of DNA. This kit allows direct sequencing of PCR-amplified DNA or DNA from plasmids, cosmids or phage. Included are protocols for sequencing using either end-labeled primer or label incorporation by primer extension. The kit uses ultra-pure deoxy-and dideoxynucleotide mixes and includes 7-deaza dGTP* to minimize problems due to band compressions. The Cycle Sequencing Kit combines conventional dideoxy sequencing reactions with thermal cycling conditions to generate high-quality sequences from very small amounts of template DNA. The Cycle Sequencing Kit provides instructions and all of the solutions and reagents required for 100 sets of dideoxy sequencing reactions using Taq DNA Polymerase. Also available from Pharmacia Biotech is the AutoCycleTM Sequencing Kit for use on ALF DNA Sequencers. The AutoCycleTM Kit allows efficient sequencing of PCR products, as well as single- and double-stranded DNA using a fluorescein-labeled primer. *Sold pursuant to a license from Boehringer Mannheim GmbH. 7-deaza GTP is covered by U.S. Patent No. 4,804,748 issued to Boehringer Mannheim GmbH. Promega fmol DNA Cycle Sequencing System The fmol DNA Cycle Sequencing System uses thermal cycle sequencing and Promega's Sequencing Grade Taq DNA polymerase* to produce sequencing data with uniform band intensity, low background, and a high degree of accuracy. Using a 32P end-labeled primer, greater than 500 bases of sequence can be obtained from as little as 4 fmol of template after an overnight exposure. The fmol DNA Cycle Sequencing System can be used for sequencing a wide variety of templates such as amplified DNA, large double-stranded DNA templates such as lambda, GC-rich templates, and palindrome-rich templates. The amount of radioisotope required per reaction using the fmol System is significantly lower than that required by many other systems. Only 5 mCi of g-35S ATP are required as compared with 10 mCi or more required by other protocols. The cycling profile using the fmol DNA Cycle Sequencing System is only 32 minutes (excluding ramp time), which saves significant time over other methods. The fmol DNA Cycle Sequencing System provides researchers a choice of two protocols for sequencing DNA: direct incorporation of label and end-labeled primer. The end-labeled primer protocol, a modification of that described by Heiner et al., uses g-32P ATP, g-33P ATP or g-35S ATP to label the sequencing primer. The end-labeled primer protocol is touted by Promega to be the most versatile sequencing method and is useful when working with l DNA, PCR templates, and any template where false priming may be a problem. This protocol generates sequence data very close to the primer and is recommended when this feature is needed. *U.S. Patent No. 5,108,892 has been issued to Promega Corporation for the use of a modified Taq DNA Polymerase to determine DNA sequences and amplify DNA sequences. Stratagene Cyclist Taq Sequencing Kit Cyclist Exo-Pfu Sequencing Kit Stratagene Cloning Systems (La Jolla, CA) offers CyclistTM DNA Sequencing Kits, which allow sequencing of dsDNA without separate denaturation and annealing steps. Use of the CyclistTM Taq DNA Sequencing Kit allows consistent sequencing of PCR products, plasmid DNA (directly from a single colony), cosmid, l, and phage eluted from a plaque. Less than 10 fmol of DNA template may be sequenced with 32P and observed after an overnight exposure to x-ray film. Recommended labels for the Taq Kit are 32P or 33P. For researchers who rely on 35S-dATP, Stratagene's CyclistTM Exo-Pfu DNA Sequencing Kit provides an alternative to standard Taq sequencing. This kit, however, is not recommended for direct sequencing from plaques or colonies. Sequencing data are derived from as little as 100 ng of plasmid DNA or PCR product. For either kit, 30 cycles are recommended, with 30-second denaturation and annealing steps and 60-second extension steps. Kits come complete with 10X sequencing buffer; ddATP, CTP, GTP, and TTP; Taq or Exo-Pfu Polymerase; Control sequencing primer; pBluescript II phagemid control template DNA; and stop mix. TaKaRa Shuzo Thermal Cycle Sequencing Kit For direct sequencing of PCR products and DNA, TaKaRa Shuzo of Japan distributes its Thermal Cycle Sequencing Kit through PanVera, Oncor, and other U.S. distributors. The 72°C reaction temperature of the TaKaRa Taq enzyme allows the synthesis of an accurate complementary strand in the absence of secondary DNA structure (double-stranded DNA can be used as the template). Since the template is used repeatedly, only 5 to 10 fmol of template DNA are required for sequence analysis. The kit employs a radioisotope-labeled primer at the 5'-end and provides all reagents necessary for primer labeling. The 100-reaction kit comes with TaKaRa Taq, 10X Cycle Buffer, dNTP-ddNTP mixture, stop solution, control template (pUC18 DNA), M13 forward and reverse primers, 10X Phosphorylation buffer, and T4 Polynucleotide Kinase. Most of the manufacturers of cycle sequencing kits spend considerable time and energy designing products with maximum performance. While several factors are used to judge performance, such as reduced template requirements, uniform peak intensities, simplified preparation, and minimal cycle times, the number of bases sequenced past the primer is probably the most asked about. The manufacturers will claim 500 to 700 bases of readable sequence, but this amount is often accomplished under ideal circumstances. Frequently, the actual range of readable sequence is considerably less for several reasons. For instance, the quality of both the sequencing gel and the DNA template contribute greatly to the success of cycle sequencing. In fact, some manufacturers recommend the use of their gel products to maximize read length, and others have specific recommendations for template preparation. Additionally, variations in the performance of the thermal cycler and the degree of primer purification play strong roles in obtaining maximum reads. Unfortunately, these are often beyond the manufacturers' control. Any well-seasoned gel jockey knows the artistry involved in casting and running sequencing gels. Preparing DNA templates and purifying primers also require adequate experience. Indeed, these areas, particularly the quality of the gels and templates, are doubly important for fluorescent automated sequencing. So, as the saying goes, your results may vary when it comes to readable sequence length. Finally, there is no substitute for experience. If possible, find somebody well-versed in DNA cycle sequencing and thoroughly pick that person's brain before making any purchasing decisions regarding cycle sequencing kits. The investment in time spent talking with an experienced technician will pay great dividends in your cycle sequencing quest. Comparison Chart Email: MDBrush@compuserve.com

Cycle Sequencing Kits

Interested in reading more?

Become a Member of